Review



promoterless cpg free vector  (InvivoGen)


Bioz Verified Symbol InvivoGen is a verified supplier
Bioz Manufacturer Symbol InvivoGen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    InvivoGen promoterless cpg free vector
    Effect of DNA methylation on Na+/H+ exchanger-3 (NHE3) promoter activity in Caco-2 cells. A: human (h) NHE3 promoter region flanking the area between −1509 and +127 (+1 is the transcription initiation site) was amplified by PCR and cloned in a <t>promoterless</t> cytosine guanine dinucleotide (CpG)-free vector upstream of the lucia gene (pCpG-EV). B: CpG-free EF1 promoter lucia vector (pCpG- hEF1) was used as control for methylation. The NHE3 promoter construct (pCpG-NHE3) and the control vector (pCpG- hEF1) were subjected to in vitro DNA methylation. The methylated and unmethylated control vector and NHE3 promoter construct were transiently transfected in Caco-2 cells along with the mammalian expression vector of β-galactosidase. Posttransfection (48 h), cells were harvested, and lucia activity and β-galactosidase activity were measured. The relative promoter activity was determined as a ratio of lucia to β-galactosidase. Results represent means ± SE of 3–4 separate experiments and are expressed as % of control comparing methylated control vector (pCpG-hEF1 methylated) or methylated NHE3 promoter construct (pCpG-NHE3 methylated) with unmethylated control vector (pCpG-hEF1) or unmethylated NHE3 promoter construct (pCpG-NHE3). **P < 0.01 compared with unmethylated vector/construct as assessed by Student's t-test. C: effect of 5-azacytidine on DNA methylation in the promoter region of NHE3 in Caco-2 cells: DNA was extracted from Caco-2 cells treated with or without 5-azacytidine (10 μM) for 48 h. DNA methylation was determined by qPCR after MethyMiner precipitation using specific primers described in materials and methods, normalized to DNA input, and expressed as fold change. Results represent means ± SE of 3–4 separate experiments. **P < 0.01 compared with untreated cells (control) as assessed by Student's t-test.
    Promoterless Cpg Free Vector, supplied by InvivoGen, used in various techniques. Bioz Stars score: 94/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/promoterless+cpg+free+vector/pCpGfree-basic-Lucia/pmc05899241-86-51-57
    Average 94 stars, based on 22 article reviews
    promoterless cpg free vector - by Bioz Stars, 2026-10
    94/100 stars

    Images

    1) Product Images from "Epigenetic modulation of intestinal Na + /H + exchanger-3 expression"

    Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression

    Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

    doi: 10.1152/ajpgi.00293.2017

    Effect of DNA methylation on Na+/H+ exchanger-3 (NHE3) promoter activity in Caco-2 cells. A: human (h) NHE3 promoter region flanking the area between −1509 and +127 (+1 is the transcription initiation site) was amplified by PCR and cloned in a promoterless cytosine guanine dinucleotide (CpG)-free vector upstream of the lucia gene (pCpG-EV). B: CpG-free EF1 promoter lucia vector (pCpG- hEF1) was used as control for methylation. The NHE3 promoter construct (pCpG-NHE3) and the control vector (pCpG- hEF1) were subjected to in vitro DNA methylation. The methylated and unmethylated control vector and NHE3 promoter construct were transiently transfected in Caco-2 cells along with the mammalian expression vector of β-galactosidase. Posttransfection (48 h), cells were harvested, and lucia activity and β-galactosidase activity were measured. The relative promoter activity was determined as a ratio of lucia to β-galactosidase. Results represent means ± SE of 3–4 separate experiments and are expressed as % of control comparing methylated control vector (pCpG-hEF1 methylated) or methylated NHE3 promoter construct (pCpG-NHE3 methylated) with unmethylated control vector (pCpG-hEF1) or unmethylated NHE3 promoter construct (pCpG-NHE3). **P < 0.01 compared with unmethylated vector/construct as assessed by Student's t-test. C: effect of 5-azacytidine on DNA methylation in the promoter region of NHE3 in Caco-2 cells: DNA was extracted from Caco-2 cells treated with or without 5-azacytidine (10 μM) for 48 h. DNA methylation was determined by qPCR after MethyMiner precipitation using specific primers described in materials and methods, normalized to DNA input, and expressed as fold change. Results represent means ± SE of 3–4 separate experiments. **P < 0.01 compared with untreated cells (control) as assessed by Student's t-test.
    Figure Legend Snippet: Effect of DNA methylation on Na+/H+ exchanger-3 (NHE3) promoter activity in Caco-2 cells. A: human (h) NHE3 promoter region flanking the area between −1509 and +127 (+1 is the transcription initiation site) was amplified by PCR and cloned in a promoterless cytosine guanine dinucleotide (CpG)-free vector upstream of the lucia gene (pCpG-EV). B: CpG-free EF1 promoter lucia vector (pCpG- hEF1) was used as control for methylation. The NHE3 promoter construct (pCpG-NHE3) and the control vector (pCpG- hEF1) were subjected to in vitro DNA methylation. The methylated and unmethylated control vector and NHE3 promoter construct were transiently transfected in Caco-2 cells along with the mammalian expression vector of β-galactosidase. Posttransfection (48 h), cells were harvested, and lucia activity and β-galactosidase activity were measured. The relative promoter activity was determined as a ratio of lucia to β-galactosidase. Results represent means ± SE of 3–4 separate experiments and are expressed as % of control comparing methylated control vector (pCpG-hEF1 methylated) or methylated NHE3 promoter construct (pCpG-NHE3 methylated) with unmethylated control vector (pCpG-hEF1) or unmethylated NHE3 promoter construct (pCpG-NHE3). **P < 0.01 compared with unmethylated vector/construct as assessed by Student's t-test. C: effect of 5-azacytidine on DNA methylation in the promoter region of NHE3 in Caco-2 cells: DNA was extracted from Caco-2 cells treated with or without 5-azacytidine (10 μM) for 48 h. DNA methylation was determined by qPCR after MethyMiner precipitation using specific primers described in materials and methods, normalized to DNA input, and expressed as fold change. Results represent means ± SE of 3–4 separate experiments. **P < 0.01 compared with untreated cells (control) as assessed by Student's t-test.

    Techniques Used: DNA Methylation Assay, Activity Assay, Amplification, Clone Assay, Plasmid Preparation, Control, Methylation, Construct, In Vitro, Transfection, Expressing

    Related Articles

    Cloning:

    Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression
    Article Snippet: .. Cloning and In Vitro Methylation of pCpG-Free NHE3 Vector For the construction of pCpG-free NHE3 vector, the DNA fragment containing the −1509/+127 region of the human NHE3 promoter was amplified using sense 5′-ATCGATGCGAGTACT GTCAGAAGACACATCCATCC -3′ and antisense 5′-ATCGATGCGAAGCTT CCCGAGTCCCCACATTGCCG -3′ primers, and the amplified promoter fragments were then inserted in a promoterless CpG-free vector (pCpG-free basic lucia; InvivoGen, San Diego, CA) upstream of the lucia reporter gene ( 23 ). .. Cloned vector was then methylated in vitro using CpG methyltransferase (M.SssI) in the presence of S -adenosylmethionine (New England Biolabs, Ipswich, MA) as described previously ( 23 ).

    Article Title: Epigenetic Modulation of Intestinal Cholesterol Transporter Niemann-Pick C1-like 1 (NPC1L1) Gene Expression by DNA Methylation
    Article Snippet: .. Cloning and in Vitro Methylation of pCpG Free-L1 Vector For the construction of pCpG free L1 vector, the DNA fragment containing −1741/+56 region of the human NPC1L1 promoter was amplified using forward 5-ATCGATGCGAGTACTTGGACTCTATCTCTCTGTGG-3′ and reverse 5-ATCGATGCGAAGCTTCCCAGGTCTGGGAAGGGGTCA-3′ primers, and the amplified promoter fragments were then inserted into a promoterless CpG free vector (pCpG free basic lucia, InvivoGen, San Diego) upstream of the lucia reporter gene. .. Cloned vector was then methylated in vitro utilizing Ss1 methylases (New England Biolabs, Frankfurt, Germany) according to the manufacturer's instruction.

    Article Title: Epigenetic Modulation of Intestinal Cholesterol Transporter Niemann-Pick C1-like 1 (NPC1L1) Gene Expression by DNA Methylation
    Article Snippet: .. Cloning and in Vitro Methylation of pCpG Free-L1 Vector— For the construction of pCpG free L1 vector, the DNA fragment containing 1741/ 56 region of the human NPC1L1 promoter was amplified using forward 5-ATCGATGCGAGTACTTGGACTCTATCTCTCTGTGG-3 and reverse 5-ATCGATGCGAAGCTTCCCAGGTCTGGGAAGGGGTCA-3 primers, and the amplified promoter fragments were then inserted into a promoterless CpG free vector (pCpG free basic lucia, InvivoGen, San Diego) upstream of the lucia reporter gene. .. Cloned vector was then methylated in vitro utilizing Ss1 methylases (New England Biolabs, Frankfurt, Germany) according to the manufacturer’s instruction.

    In Vitro:

    Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression
    Article Snippet: .. Cloning and In Vitro Methylation of pCpG-Free NHE3 Vector For the construction of pCpG-free NHE3 vector, the DNA fragment containing the −1509/+127 region of the human NHE3 promoter was amplified using sense 5′-ATCGATGCGAGTACT GTCAGAAGACACATCCATCC -3′ and antisense 5′-ATCGATGCGAAGCTT CCCGAGTCCCCACATTGCCG -3′ primers, and the amplified promoter fragments were then inserted in a promoterless CpG-free vector (pCpG-free basic lucia; InvivoGen, San Diego, CA) upstream of the lucia reporter gene ( 23 ). .. Cloned vector was then methylated in vitro using CpG methyltransferase (M.SssI) in the presence of S -adenosylmethionine (New England Biolabs, Ipswich, MA) as described previously ( 23 ).

    Article Title: Epigenetic Modulation of Intestinal Cholesterol Transporter Niemann-Pick C1-like 1 (NPC1L1) Gene Expression by DNA Methylation
    Article Snippet: .. Cloning and in Vitro Methylation of pCpG Free-L1 Vector For the construction of pCpG free L1 vector, the DNA fragment containing −1741/+56 region of the human NPC1L1 promoter was amplified using forward 5-ATCGATGCGAGTACTTGGACTCTATCTCTCTGTGG-3′ and reverse 5-ATCGATGCGAAGCTTCCCAGGTCTGGGAAGGGGTCA-3′ primers, and the amplified promoter fragments were then inserted into a promoterless CpG free vector (pCpG free basic lucia, InvivoGen, San Diego) upstream of the lucia reporter gene. .. Cloned vector was then methylated in vitro utilizing Ss1 methylases (New England Biolabs, Frankfurt, Germany) according to the manufacturer's instruction.

    Article Title: Epigenetic Modulation of Intestinal Cholesterol Transporter Niemann-Pick C1-like 1 (NPC1L1) Gene Expression by DNA Methylation
    Article Snippet: .. Cloning and in Vitro Methylation of pCpG Free-L1 Vector— For the construction of pCpG free L1 vector, the DNA fragment containing 1741/ 56 region of the human NPC1L1 promoter was amplified using forward 5-ATCGATGCGAGTACTTGGACTCTATCTCTCTGTGG-3 and reverse 5-ATCGATGCGAAGCTTCCCAGGTCTGGGAAGGGGTCA-3 primers, and the amplified promoter fragments were then inserted into a promoterless CpG free vector (pCpG free basic lucia, InvivoGen, San Diego) upstream of the lucia reporter gene. .. Cloned vector was then methylated in vitro utilizing Ss1 methylases (New England Biolabs, Frankfurt, Germany) according to the manufacturer’s instruction.

    Methylation:

    Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression
    Article Snippet: .. Cloning and In Vitro Methylation of pCpG-Free NHE3 Vector For the construction of pCpG-free NHE3 vector, the DNA fragment containing the −1509/+127 region of the human NHE3 promoter was amplified using sense 5′-ATCGATGCGAGTACT GTCAGAAGACACATCCATCC -3′ and antisense 5′-ATCGATGCGAAGCTT CCCGAGTCCCCACATTGCCG -3′ primers, and the amplified promoter fragments were then inserted in a promoterless CpG-free vector (pCpG-free basic lucia; InvivoGen, San Diego, CA) upstream of the lucia reporter gene ( 23 ). .. Cloned vector was then methylated in vitro using CpG methyltransferase (M.SssI) in the presence of S -adenosylmethionine (New England Biolabs, Ipswich, MA) as described previously ( 23 ).

    Article Title: Epigenetic Modulation of Intestinal Cholesterol Transporter Niemann-Pick C1-like 1 (NPC1L1) Gene Expression by DNA Methylation
    Article Snippet: .. Cloning and in Vitro Methylation of pCpG Free-L1 Vector For the construction of pCpG free L1 vector, the DNA fragment containing −1741/+56 region of the human NPC1L1 promoter was amplified using forward 5-ATCGATGCGAGTACTTGGACTCTATCTCTCTGTGG-3′ and reverse 5-ATCGATGCGAAGCTTCCCAGGTCTGGGAAGGGGTCA-3′ primers, and the amplified promoter fragments were then inserted into a promoterless CpG free vector (pCpG free basic lucia, InvivoGen, San Diego) upstream of the lucia reporter gene. .. Cloned vector was then methylated in vitro utilizing Ss1 methylases (New England Biolabs, Frankfurt, Germany) according to the manufacturer's instruction.

    Article Title: Epigenetic Modulation of Intestinal Cholesterol Transporter Niemann-Pick C1-like 1 (NPC1L1) Gene Expression by DNA Methylation
    Article Snippet: .. Cloning and in Vitro Methylation of pCpG Free-L1 Vector— For the construction of pCpG free L1 vector, the DNA fragment containing 1741/ 56 region of the human NPC1L1 promoter was amplified using forward 5-ATCGATGCGAGTACTTGGACTCTATCTCTCTGTGG-3 and reverse 5-ATCGATGCGAAGCTTCCCAGGTCTGGGAAGGGGTCA-3 primers, and the amplified promoter fragments were then inserted into a promoterless CpG free vector (pCpG free basic lucia, InvivoGen, San Diego) upstream of the lucia reporter gene. .. Cloned vector was then methylated in vitro utilizing Ss1 methylases (New England Biolabs, Frankfurt, Germany) according to the manufacturer’s instruction.

    Amplification:

    Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression
    Article Snippet: .. Cloning and In Vitro Methylation of pCpG-Free NHE3 Vector For the construction of pCpG-free NHE3 vector, the DNA fragment containing the −1509/+127 region of the human NHE3 promoter was amplified using sense 5′-ATCGATGCGAGTACT GTCAGAAGACACATCCATCC -3′ and antisense 5′-ATCGATGCGAAGCTT CCCGAGTCCCCACATTGCCG -3′ primers, and the amplified promoter fragments were then inserted in a promoterless CpG-free vector (pCpG-free basic lucia; InvivoGen, San Diego, CA) upstream of the lucia reporter gene ( 23 ). .. Cloned vector was then methylated in vitro using CpG methyltransferase (M.SssI) in the presence of S -adenosylmethionine (New England Biolabs, Ipswich, MA) as described previously ( 23 ).

    Article Title: Epigenetic Modulation of Intestinal Cholesterol Transporter Niemann-Pick C1-like 1 (NPC1L1) Gene Expression by DNA Methylation
    Article Snippet: .. For the construction of pCpG free L1 vector, the DNA fragment containing −1741/+56 region of the human NPC1L1 promoter was amplified using forward 5-ATCGATGCGAGTACTTGGACTCTATCTCTCTGTGG-3′ and reverse 5-ATCGATGCGAAGCTTCCCAGGTCTGGGAAGGGGTCA-3′ primers, and the amplified promoter fragments were then inserted into a promoterless CpG free vector (pCpG free basic lucia, InvivoGen, San Diego) upstream of the lucia reporter gene. .. Equal amounts of RNA from control and treated samples were reverse-transcribed and amplified in a one-step reaction utilizing Brilliant SYBR Green QRT-PCR master mix kit (Stratagene, Clara, CA).

    Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression
    Article Snippet: .. For the construction of pCpG-free NHE3 vector, the DNA fragment containing the −1509/+127 region of the human NHE3 promoter was amplified using sense 5′-ATCGATGCGAGTACT GTCAGAAGACACATCCATCC -3′ and antisense 5′-ATCGATGCGAAGCTT CCCGAGTCCCCACATTGCCG -3′ primers, and the amplified promoter fragments were then inserted in a promoterless CpG-free vector (pCpG-free basic lucia; InvivoGen, San Diego, CA) upstream of the lucia reporter gene ( 23 ). .. Cloned vector was then methylated in vitro using CpG methyltransferase (M.SssI) in the presence of S -adenosylmethionine (New England Biolabs, Ipswich, MA) as described previously ( 23 ).

    Article Title: Epigenetic Modulation of Intestinal Cholesterol Transporter Niemann-Pick C1-like 1 (NPC1L1) Gene Expression by DNA Methylation
    Article Snippet: .. Cloning and in Vitro Methylation of pCpG Free-L1 Vector For the construction of pCpG free L1 vector, the DNA fragment containing −1741/+56 region of the human NPC1L1 promoter was amplified using forward 5-ATCGATGCGAGTACTTGGACTCTATCTCTCTGTGG-3′ and reverse 5-ATCGATGCGAAGCTTCCCAGGTCTGGGAAGGGGTCA-3′ primers, and the amplified promoter fragments were then inserted into a promoterless CpG free vector (pCpG free basic lucia, InvivoGen, San Diego) upstream of the lucia reporter gene. .. Cloned vector was then methylated in vitro utilizing Ss1 methylases (New England Biolabs, Frankfurt, Germany) according to the manufacturer's instruction.

    Article Title: Epigenetic Modulation of Intestinal Cholesterol Transporter Niemann-Pick C1-like 1 (NPC1L1) Gene Expression by DNA Methylation
    Article Snippet: .. Cloning and in Vitro Methylation of pCpG Free-L1 Vector— For the construction of pCpG free L1 vector, the DNA fragment containing 1741/ 56 region of the human NPC1L1 promoter was amplified using forward 5-ATCGATGCGAGTACTTGGACTCTATCTCTCTGTGG-3 and reverse 5-ATCGATGCGAAGCTTCCCAGGTCTGGGAAGGGGTCA-3 primers, and the amplified promoter fragments were then inserted into a promoterless CpG free vector (pCpG free basic lucia, InvivoGen, San Diego) upstream of the lucia reporter gene. .. Cloned vector was then methylated in vitro utilizing Ss1 methylases (New England Biolabs, Frankfurt, Germany) according to the manufacturer’s instruction.

    Plasmid Preparation:

    Article Title: Epigenetic Modulation of Intestinal Cholesterol Transporter Niemann-Pick C1-like 1 (NPC1L1) Gene Expression by DNA Methylation
    Article Snippet: .. For the construction of pCpG free L1 vector, the DNA fragment containing −1741/+56 region of the human NPC1L1 promoter was amplified using forward 5-ATCGATGCGAGTACTTGGACTCTATCTCTCTGTGG-3′ and reverse 5-ATCGATGCGAAGCTTCCCAGGTCTGGGAAGGGGTCA-3′ primers, and the amplified promoter fragments were then inserted into a promoterless CpG free vector (pCpG free basic lucia, InvivoGen, San Diego) upstream of the lucia reporter gene. .. Equal amounts of RNA from control and treated samples were reverse-transcribed and amplified in a one-step reaction utilizing Brilliant SYBR Green QRT-PCR master mix kit (Stratagene, Clara, CA).

    Article Title: Epigenetic Modulation of Intestinal Cholesterol Transporter Niemann-Pick C1-like 1 (NPC1L1) Gene Expression by DNA Methylation
    Article Snippet: .. Cloning and in Vitro Methylation of pCpG Free-L1 Vector For the construction of pCpG free L1 vector, the DNA fragment containing −1741/+56 region of the human NPC1L1 promoter was amplified using forward 5-ATCGATGCGAGTACTTGGACTCTATCTCTCTGTGG-3′ and reverse 5-ATCGATGCGAAGCTTCCCAGGTCTGGGAAGGGGTCA-3′ primers, and the amplified promoter fragments were then inserted into a promoterless CpG free vector (pCpG free basic lucia, InvivoGen, San Diego) upstream of the lucia reporter gene. .. Cloned vector was then methylated in vitro utilizing Ss1 methylases (New England Biolabs, Frankfurt, Germany) according to the manufacturer's instruction.

    Article Title: Epigenetic Modulation of Intestinal Cholesterol Transporter Niemann-Pick C1-like 1 (NPC1L1) Gene Expression by DNA Methylation
    Article Snippet: .. Cloning and in Vitro Methylation of pCpG Free-L1 Vector— For the construction of pCpG free L1 vector, the DNA fragment containing 1741/ 56 region of the human NPC1L1 promoter was amplified using forward 5-ATCGATGCGAGTACTTGGACTCTATCTCTCTGTGG-3 and reverse 5-ATCGATGCGAAGCTTCCCAGGTCTGGGAAGGGGTCA-3 primers, and the amplified promoter fragments were then inserted into a promoterless CpG free vector (pCpG free basic lucia, InvivoGen, San Diego) upstream of the lucia reporter gene. .. Cloned vector was then methylated in vitro utilizing Ss1 methylases (New England Biolabs, Frankfurt, Germany) according to the manufacturer’s instruction.



    Similar Products

    promoterless cpg free vector  (InvivoGen)
    94
    InvivoGen promoterless cpg free vector
    Effect of DNA methylation on Na+/H+ exchanger-3 (NHE3) promoter activity in Caco-2 cells. A: human (h) NHE3 promoter region flanking the area between −1509 and +127 (+1 is the transcription initiation site) was amplified by PCR and cloned in a <t>promoterless</t> cytosine guanine dinucleotide (CpG)-free vector upstream of the lucia gene (pCpG-EV). B: CpG-free EF1 promoter lucia vector (pCpG- hEF1) was used as control for methylation. The NHE3 promoter construct (pCpG-NHE3) and the control vector (pCpG- hEF1) were subjected to in vitro DNA methylation. The methylated and unmethylated control vector and NHE3 promoter construct were transiently transfected in Caco-2 cells along with the mammalian expression vector of β-galactosidase. Posttransfection (48 h), cells were harvested, and lucia activity and β-galactosidase activity were measured. The relative promoter activity was determined as a ratio of lucia to β-galactosidase. Results represent means ± SE of 3–4 separate experiments and are expressed as % of control comparing methylated control vector (pCpG-hEF1 methylated) or methylated NHE3 promoter construct (pCpG-NHE3 methylated) with unmethylated control vector (pCpG-hEF1) or unmethylated NHE3 promoter construct (pCpG-NHE3). **P < 0.01 compared with unmethylated vector/construct as assessed by Student's t-test. C: effect of 5-azacytidine on DNA methylation in the promoter region of NHE3 in Caco-2 cells: DNA was extracted from Caco-2 cells treated with or without 5-azacytidine (10 μM) for 48 h. DNA methylation was determined by qPCR after MethyMiner precipitation using specific primers described in materials and methods, normalized to DNA input, and expressed as fold change. Results represent means ± SE of 3–4 separate experiments. **P < 0.01 compared with untreated cells (control) as assessed by Student's t-test.
    Promoterless Cpg Free Vector, supplied by InvivoGen, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/promoterless+cpg+free+vector/pCpGfree-basic-Lucia/pmc05899241-86-51-57
    Average 94 stars, based on 1 article reviews
    promoterless cpg free vector - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier

    Image Search Results


    Effect of DNA methylation on Na+/H+ exchanger-3 (NHE3) promoter activity in Caco-2 cells. A: human (h) NHE3 promoter region flanking the area between −1509 and +127 (+1 is the transcription initiation site) was amplified by PCR and cloned in a promoterless cytosine guanine dinucleotide (CpG)-free vector upstream of the lucia gene (pCpG-EV). B: CpG-free EF1 promoter lucia vector (pCpG- hEF1) was used as control for methylation. The NHE3 promoter construct (pCpG-NHE3) and the control vector (pCpG- hEF1) were subjected to in vitro DNA methylation. The methylated and unmethylated control vector and NHE3 promoter construct were transiently transfected in Caco-2 cells along with the mammalian expression vector of β-galactosidase. Posttransfection (48 h), cells were harvested, and lucia activity and β-galactosidase activity were measured. The relative promoter activity was determined as a ratio of lucia to β-galactosidase. Results represent means ± SE of 3–4 separate experiments and are expressed as % of control comparing methylated control vector (pCpG-hEF1 methylated) or methylated NHE3 promoter construct (pCpG-NHE3 methylated) with unmethylated control vector (pCpG-hEF1) or unmethylated NHE3 promoter construct (pCpG-NHE3). **P < 0.01 compared with unmethylated vector/construct as assessed by Student's t-test. C: effect of 5-azacytidine on DNA methylation in the promoter region of NHE3 in Caco-2 cells: DNA was extracted from Caco-2 cells treated with or without 5-azacytidine (10 μM) for 48 h. DNA methylation was determined by qPCR after MethyMiner precipitation using specific primers described in materials and methods, normalized to DNA input, and expressed as fold change. Results represent means ± SE of 3–4 separate experiments. **P < 0.01 compared with untreated cells (control) as assessed by Student's t-test.

    Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

    Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression

    doi: 10.1152/ajpgi.00293.2017

    Figure Lengend Snippet: Effect of DNA methylation on Na+/H+ exchanger-3 (NHE3) promoter activity in Caco-2 cells. A: human (h) NHE3 promoter region flanking the area between −1509 and +127 (+1 is the transcription initiation site) was amplified by PCR and cloned in a promoterless cytosine guanine dinucleotide (CpG)-free vector upstream of the lucia gene (pCpG-EV). B: CpG-free EF1 promoter lucia vector (pCpG- hEF1) was used as control for methylation. The NHE3 promoter construct (pCpG-NHE3) and the control vector (pCpG- hEF1) were subjected to in vitro DNA methylation. The methylated and unmethylated control vector and NHE3 promoter construct were transiently transfected in Caco-2 cells along with the mammalian expression vector of β-galactosidase. Posttransfection (48 h), cells were harvested, and lucia activity and β-galactosidase activity were measured. The relative promoter activity was determined as a ratio of lucia to β-galactosidase. Results represent means ± SE of 3–4 separate experiments and are expressed as % of control comparing methylated control vector (pCpG-hEF1 methylated) or methylated NHE3 promoter construct (pCpG-NHE3 methylated) with unmethylated control vector (pCpG-hEF1) or unmethylated NHE3 promoter construct (pCpG-NHE3). **P < 0.01 compared with unmethylated vector/construct as assessed by Student's t-test. C: effect of 5-azacytidine on DNA methylation in the promoter region of NHE3 in Caco-2 cells: DNA was extracted from Caco-2 cells treated with or without 5-azacytidine (10 μM) for 48 h. DNA methylation was determined by qPCR after MethyMiner precipitation using specific primers described in materials and methods, normalized to DNA input, and expressed as fold change. Results represent means ± SE of 3–4 separate experiments. **P < 0.01 compared with untreated cells (control) as assessed by Student's t-test.

    Article Snippet: Cloning and In Vitro Methylation of pCpG-Free NHE3 Vector For the construction of pCpG-free NHE3 vector, the DNA fragment containing the −1509/+127 region of the human NHE3 promoter was amplified using sense 5′-ATCGATGCGAGTACT GTCAGAAGACACATCCATCC -3′ and antisense 5′-ATCGATGCGAAGCTT CCCGAGTCCCCACATTGCCG -3′ primers, and the amplified promoter fragments were then inserted in a promoterless CpG-free vector (pCpG-free basic lucia; InvivoGen, San Diego, CA) upstream of the lucia reporter gene ( 23 ).

    Techniques: DNA Methylation Assay, Activity Assay, Amplification, Clone Assay, Plasmid Preparation, Control, Methylation, Construct, In Vitro, Transfection, Expressing